Shout out to Dr. Tyre: For great info and modeling of the viruses; https://drewtyre.rbind.io
This post will be nothing like his. Mine is mined from news reports with very little bio info at the end, his is all about modeling, with real actually data and such.
On that note, hope you’re all keeping safe.
Amongst the madness of a president over his head and trying to hold on to some semblance that he has some kind of control, and other nut jobs, like Roger Stone, declaring that Bill Gates may have created Covid-19 in order to get microchips into people, there is some reasonable news, and maybe, just maybe, some good news on the horizon.
Scientist have stepped up. In an amazingly short time, several avenues of research have progressed. There are already potential vaccines and treatments going through trials.
The basic biology of the virus has also been elucidated. They have determined the pathways within our cells that allow the virus to get inside. They have determined the causes that make this virus so deadly. One is the cytosine storm, our bodies own immune response that get overblown and ends up causing huge levels of damage. Hyper-inflammation.
The basic biology behind how the virus works, and what is does within our bodies, will help lead to even more treatment possibilities.
Knowledge is power. This may seem an odd statement in an age where an idiot is president of the U.S. The accumulated knowledge of science, and the dedication and collective brains of the scientists, may yet save us from this scourge, and the dufus, who’s stupidity would lead us to destruction. Governors have been stupid too, not all, but several; Governors of South Carolina, Georgia, Tennessee, and Florida have been particularly stupid, opening up things in their states before they have even hit a peak of the disease. But back the biology.
Trials of Vaccines:
This has already begun. Before April showers began volunteers had been injected with potential vaccines. Five different trials were already going.
First vaccine potential was mRNA-1273, and the first subject was injected back in the middle of March. For those not in the know about the rapidity of science, this is science at the speed of light.
The goal of this injection is similar to the yearly flu shot, in that it’s supposed to get our bodies to produce an immune response to the virus. IN some cases of immunizations n immune response is caused because the virus itself is injected (killed, and in low doses). That is not the case here, instead the injection is supposed to get our own bodies to produce a viral protein, that then, let us hope, our immune system (think white blood cells) recognize and pull the alarm switch. The immune repose that results is expected to, among other things, produce memory cells that hold information about the viral protein. Then, if the person gets infected by the real virus, the immune response will be rapid and elimination of the virus from the body will result.
Without memory cells, that hold information about the virus, an immune response can take 2 weeks or longer to get rolling. Two weeks of virus replication.
More potential vaccines are lining up:
aAPC — this is an engineered minigene, modified to produce artificial viral antigens (the parts that the immune system should recognize and mount a defense against). aAPC, is only one of a series of engineered vaccines going into trials.
BCG is being trialed. This is a vaccine against tuberculosis, however, it seems to offer protection against a number of other infectious agents…so…WTF lets give it a go.
They are also trying inactivated Covid-19. There are trials of one and two injections, at several dosages. This is one of the research pathways that, back in the day, led to some of the first vaccines.
In order to speed things up some companies are starting to produce potential vaccines before trials are complete: Johnson and Johnson are doing this. The is more than a bit speculative, but if it turns out that that particular clinical trial yields results, a vaccine will be ready to go.
Quick History of vaccines:
Cowpox was injected to try to give immunity against smallpox, and it worked: Edward Jenner in 1796.
Pasteur, did injections of live but reduced cholera, and then inactivated anthrax. Late 1800’s into early 1900’s.
The BCG vaccine, mentioned above, was developed in the early 1900’s.
These and other vaccines developed by 1940’s: Smallpox, Diphtheria, Tetanus, Whooping cough (Pertussis),
Polio vaccine, was developed in the 1950’s
By the 1960’s measles, mumps and rubella were added to the list.
Science has overcome many deadly diseases with vaccines. Anti-vaxxers are idiots.
Treatment Drugs:
There are many more trials of treatment drugs, more than 200, than vaccines. Here are just a few.
One possible treatment drug going through trials is the too often mentioned drug touted by the Mango Mussolini that calls himself president of the U.S. Several trials of this drug have been shut down because it causes dangerous heart irregularities when given in high doses. Taking the drug has lead to deaths around the world due to this heart connection. Yet still, this drug is going through further trails and, disturbingly, this drug is being used in some hospitals as a potential treatment despite its dangers and the lack of any information that it might help.
Remdesivir, a drug tested against Ebola, is another drug in treatment trials. At this point there are some worthwhile results, 68% of those taking the drug showed improvement. However, the results of this need to be taken in context. This was not a clinical trial with controls and treatment groups. This was given as a expanded use drug, in order to help those without many options. So we do not know how many of that 68% would have recovered without the drug. Controlled trials are ongoing, this is somewhat disappointing that more data is not available since trials with this drug began at the end of February.
Late breaking, the first trial of this drug just reported no positive effects of the treatment. The experiment had a robust sample, 200+ adults. The trial has been stopped due to side-effects :-(
Lopinavir with Ritonavir, HIV treatment drugs, are being tried as well.
Those dang viruses are tough to combat. I wouldn’t expect a treatment anytime soon.
Physiology 101 about Covid-19
This virus is a RNA virus. That is, its genetic material is a single strand of nucleic acids.
There are four nucleic acids in RNA, they are usually referred to as the first letter of the name; Adenine, Guanine, Cytosine, and Uracil (A, G, C, and U). Three of these are also found in DNA A, G, and C, and the fourth in DNA is Thymine (T). These molecules are called nitrogenous bases and are typically referred to just as bases.
The viruses RNA sequence begins auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgau, and continues for
30 thousand bases.
The virus accesses the body cells though the ACE2 receptor:
This receptor helps keep blood pressure in check, in part by using with bradykinin, bradykinin promotes inflammation. This begins a process that leads to leakage of the capillaries (the smallest blood vessels). When blood leaks out of the blood vessels blood pressure drops.
The whole virus does not need to enter the body cell. Instead the instructional molecule does (RNA in this case). The RNA of the virus then highjacks the cells own instructional materials DNA and RNA, and directs it to make more viruses. The spiky bit on the virus helps it to stick and help it to get its RNA into body cells.
Lung connection #1:
One of the bodies defensive responses to an invader is the release of cytokines and other inflammatory agents. One of the jobs of these molecules is to send signals calling other immunes cells to the area. “ Hey, you, B-cell, come over here”.
The cytokines erupt, in part, due to the regulation of interferon regulatory factor 5 (a cytokine itself). As the name suggest, these molecules tend to ‘interfere’ with viral replication (this is just one of their functions). This pathway requires other things but let’s keep to the basics.
In some people a huge number of cytokines are produced causing what has been called a cytokine storm (Officially called Cytokine release syndrome). Uncontrolled inflammation…yikes. Inflammation, when mild is annoying. Those with mild allergies know this. Inflammation ramped up, can be deadly. For example, breathing passages swell so no air can flow.
The cytokines also drive up glucose metabolism; immune cells will need to divide and they need energy to do that, viruses also need glucose so this could limit the glucose they have available. Mortality is higher in diabetics.
Lung connection #2:
Fluid build up due to inflammation, causes damage to the lung tissue. Deep in the lungs the tissue is thin and susceptible to damage.
Why do some people produce a cytokine storm?
Unknown. Speculation is that a more developed immune systems, as in older adults, leads to an increase in the likelihood of a cytokine storm.
Again, keep safe. Let me know if you see any zombies.